Ask Experts Questions for FREE Help !
Ask
    Chanel911's Avatar
    Chanel911 Posts: 8, Reputation: 1
    New Member
     
    #1

    Mar 18, 2009, 12:04 PM
    DNA Melting
    Here are the DNA sequences from 2 different regions of the genome of an organism.
    Region 1: 3’ – ATTAGAATGGTTAGCCAATATATA – 5’
    Region 2: 3’ – GGCTGCCAGCGCAGGGCTTAGG – 5’
    Which of these would require a higher temperature to melt & why?
    jem02081's Avatar
    jem02081 Posts: 65, Reputation: 19
    Junior Member
     
    #2

    Mar 21, 2009, 03:51 PM
    Since this appears to be a homework question I’ll just give you a couple of hints.
    First, Region 1 is longer
    Second, Region 2 has a much higher G+C content

    Which has the higher Tm? Try googling oligo & tm. You will find quite a few Tm calculators which will answer this question

    The answer to why depends how sophisticated of an answer you need. The question could be asked in high school or college. For a reasonably sophisticated answer see "DNA denaturation" as Wikipedia.
    210531476's Avatar
    210531476 Posts: 1, Reputation: 1
    New Member
     
    #3

    Mar 28, 2012, 10:43 AM
    Region 2 has require a higher temperature to melt because it consist of much higher G and C content which have strong bonds between them and which therefore require a higher temperature to break

Not your question? Ask your question View similar questions

 

Question Tools Search this Question
Search this Question:

Advanced Search

Add your answer here.


Check out some similar questions!

Melting Granite. [ 3 Answers ]

Hi! My name is DJ, and my question is: What is the "hardest granite" it's name, the easiest to obtain, and how do I melt it?

Melting contact lenses? [ 7 Answers ]

I received a forwarded email that advised people who wear contacts to keep away from very hot heat sources (i.e. fires). Supposedly some guy's contact lenses melted when he was BBQ-ing, which caused him to become blind. I'm rather skeptical about this message (as I am with most forwards of this...

The melting princess [ 10 Answers ]

Once upon a time there lived a king. The king had a beautiful daughter, the PRINCESS, but there was a problem. Everything the princess touched would Melt, no matter what; Metal, Wood, Stone,

Melting point [ 3 Answers ]

Given that the melting point of water at 218 atm is 1.61 Celsius degree,what is the melting point of water at 0.5 atm? :) Can anyone show me step by step for the calculation? :D Thanks a lot to anyone who help me to solve the problem.your help is most appreciated. :) :)


View more questions Search