Ask Me Help Desk

Ask Me Help Desk (https://www.askmehelpdesk.com/forum.php)
-   Biology (https://www.askmehelpdesk.com/forumdisplay.php?f=50)
-   -   DNA Melting (https://www.askmehelpdesk.com/showthread.php?t=330882)

  • Mar 18, 2009, 12:04 PM
    Chanel911
    DNA Melting
    Here are the DNA sequences from 2 different regions of the genome of an organism.
    Region 1: 3’ – ATTAGAATGGTTAGCCAATATATA – 5’
    Region 2: 3’ – GGCTGCCAGCGCAGGGCTTAGG – 5’
    Which of these would require a higher temperature to melt & why?
  • Mar 21, 2009, 03:51 PM
    jem02081
    Since this appears to be a homework question I’ll just give you a couple of hints.
    First, Region 1 is longer
    Second, Region 2 has a much higher G+C content

    Which has the higher Tm? Try googling oligo & tm. You will find quite a few Tm calculators which will answer this question

    The answer to why depends how sophisticated of an answer you need. The question could be asked in high school or college. For a reasonably sophisticated answer see "DNA denaturation" as Wikipedia.
  • Mar 28, 2012, 10:43 AM
    210531476
    Region 2 has require a higher temperature to melt because it consist of much higher G and C content which have strong bonds between them and which therefore require a higher temperature to break

  • All times are GMT -7. The time now is 07:11 AM.