Ask Experts Questions for FREE Help !
Ask
    jeffpas's Avatar
    jeffpas Posts: 6, Reputation: 1
    New Member
     
    #1

    May 25, 2010, 02:00 AM
    Please help- Attic is melting!
    Hi All,

    My Dependable Ninety-Two (Goodman) furnace is not so dependable anymore!

    The heat works fine, but when turning on the central fan or A/C, the fan simply won't kick on. The freon can be heard moving around in the pipes (I know, don't leave it going without the fan).

    I absolutely can't afford to hire out, so its fix this myself or ruin. Unfortunately temperatures got up to 95 today and humid as heck. I ran a dehumidfier upstairs but it still got up to 98 degrees. Tonight I can see the floor boards are starting to warp up there. Who knows what damage the roof is taking. :madhell:

    Does anyone know what part is blown in the Goodman furnace, that would allow the heat to work fine but no manual fan or A/C? I assume this would be a separate fuse but I can't see anything anywhere that might be the cause. Thanks for any advice...

    jeffpas
    smoothy's Avatar
    smoothy Posts: 25,490, Reputation: 2853
    Uber Member
     
    #2

    May 25, 2010, 04:51 AM

    YOU should NOT hear freon in the lines... and if there is either insufficient freon, its NOT going to come on. And you do need special tools (manifold guages) to determine if the charge level is sufficient.
    Joshdta's Avatar
    Joshdta Posts: 2,549, Reputation: 45
    Ultra Member
     
    #3

    May 25, 2010, 05:30 AM
    Quote Originally Posted by smoothy View Post
    YOU should NOT hear freon in the lines....and if there is either insufficient freon, its NOT going to come on. And you do need special tools (manifold guages) to determine if the charge level is sufficent.

    You will here the freon if the blower is not running. The only thing it could be is the control board cooling relay has went bad. You could try to get it to work temperarely is to take the black wire off the cool terminal on the control board and put it to eac, or hum. Each of these should have its own relay. Or you could wire the fan direct, but by wiring direct the fan will not shut off.
    jeffpas's Avatar
    jeffpas Posts: 6, Reputation: 1
    New Member
     
    #4

    May 25, 2010, 07:02 AM

    >>take the black wire off the cool terminal on the control board and put it to eac, or hum. Each of these should have its own relay.. >>

    Thanks for the advice, but could you repeat this with less hvac jargon? I found a fan control center board for sale here:

    Fan Control Center Goodman B1141702

    As far as bypassing the relay temporarily just so that my attic doesn't melt, that would be fantastic, it looks like this device has 2 black wires and 5 attachment screws. There does not appear to be any other fan cooling relay for sale under Goodman I can find under Google. Thanks much for any clarification... jeffpas
    jeffpas's Avatar
    jeffpas Posts: 6, Reputation: 1
    New Member
     
    #5

    May 25, 2010, 07:18 AM
    Thanks my apologies... just don't want to misunderstand you and blow up my furnace. It doesn't seem like a very complicated fix just to bypass it. If I can replace the fan control center and take care of the problem that would be great, that is, IF the only one I can find for sale is the right model.

    Here is a picture of the furnace (attached):

    Checking the cover and it looks like there is a integrated circuit board, an HSI Relay, an Indoor Blower Relay, a Limit Switch and a Pressure Switch.
    Attached Images
     
    jeffpas's Avatar
    jeffpas Posts: 6, Reputation: 1
    New Member
     
    #6

    May 25, 2010, 09:17 AM

    Hey guys, I think I found the answer to this problem, at least in my case!
    I was talking to an HVAC parts seller and he had me try taking the thermostat off the wall upstairs. He had me connect the G and R contacts to see if the fan came on, and the R and Y contacts to see if the air condition unit came on (please double check these before attempting, I'm not taking the thing off to verify, not pushing my luck ;)

    They both did. This seemed to indicate the problem was with the thermostat, not the actual furnace in the basement.
    At any rate I had about 3 months ago replaced the thermostat with a programmable one and had forgotten that I had never tried to use the air since.

    Not only did it work hotwired, but when I reseated the thermostat on the contacts, the air worked! So at least at this point, it looks as if it was either a poorly seated thermostat or a temporary default in it.
    Thanks for advice, it looks like I got lucky this time--- the house certainly appreciates it. :)
    smoothy's Avatar
    smoothy Posts: 25,490, Reputation: 2853
    Uber Member
     
    #7

    May 25, 2010, 11:08 AM

    Great... glad it turned out to be something this simple... and best of all. Free.

Not your question? Ask your question View similar questions

 

Question Tools Search this Question
Search this Question:

Advanced Search

Add your answer here.


Check out some similar questions!

DNA Melting [ 2 Answers ]

Here are the DNA sequences from 2 different regions of the genome of an organism. Region 1: 3’ – ATTAGAATGGTTAGCCAATATATA – 5’ Region 2: 3’ – GGCTGCCAGCGCAGGGCTTAGG – 5’ Which of these would require a higher temperature to melt & why?

Melting Granite. [ 3 Answers ]

Hi! My name is DJ, and my question is: What is the "hardest granite" it's name, the easiest to obtain, and how do I melt it?

How do I splice the wires in the attic to put a light and a plug socket in the attic [ 3 Answers ]

How do I splice wires in the attic to install a plug socket

Cheese not melting [ 6 Answers ]

I have had a problem every time I go to make baked homemade macaroni and cheese. The cheese doesn't melt any more. It globs up and doesn't mix with the sauce. I think it is because they probably make it low fat without the fat content that it use to contain. I think they are making cheese like...

The melting princess [ 10 Answers ]

Once upon a time there lived a king. The king had a beautiful daughter, the PRINCESS, but there was a problem. Everything the princess touched would Melt, no matter what; Metal, Wood, Stone,


View more questions Search