Ask Me Help Desk

Ask Me Help Desk (https://www.askmehelpdesk.com/forum.php)
-   Biology (https://www.askmehelpdesk.com/forumdisplay.php?f=50)
-   -   What is the complementary base for. (https://www.askmehelpdesk.com/showthread.php?t=208232)

  • Apr 21, 2008, 04:44 PM
    amber amerson
    What is the complementary base for.
    What is the complementary base for AUGUCGAUCACCAUUGAAGGUAGACUG?
  • Apr 21, 2008, 04:55 PM
    massplumber2008
    This is an RNA strand...

    The complimentary base is as follows:

    A gets U
    C gets G
    G gets C
    U gets A

    So... AUGUCGAUCACCAUUGAAGGUAGACUG complimentary base should be:

    UACAGCUAGUGGUAACUUCCAUCUGAC.

    Good luck!
  • Apr 21, 2008, 06:37 PM
    jem02081
    If your want to "use" this RNA you need to keep track of the ends
    DNA & RNA sequences are written 5' -> 3' so the complement of
    5' AUGUCGAUCACCAUUGAAGGUAGACUG 3' would be written as
    5' CAGUCUACCUUCAAUGGUGAUCGACAU 3'

  • All times are GMT -7. The time now is 06:11 AM.