Search:
Type: Posts; User: jem02081
Search:
Search took 0.00 seconds.
-
1. "For years now surgeons have been using organs from pigs to transplant into humans"... No they haven't; well not successfully! However, some people are working on genetically engineering sheep or...
-
Intramural fibroids are a type of intrauterine fibroids
Try googling intrauterine fibroids or uterine fibroids for more info
Try sites such as
En.wikipedia.org/wiki/Uterine_fibroid...
-
The 16.2p11 terminology refers to a region on the short arm (p) of chromosome 16.
See 16p11.2 Microdeletion - GeneReviews - NCBI Bookshelf
-
Unfortunately, the answer to your question is that it depends on the extraction method. With an extraction method like http://learn.genetics.utah.edu/archive/wheatgerm/index.html
I suspect the...
-
I can give you our 6 closest relatives. They are the other (non-human) members of the Family Hominidae includes 6 species
• Bornean orangutan, Pongo pygmaeus
• Sumatran orangutan, Pongo abelii...
-
No, we didn't evolve from any animal alive today (chimps or pigs). We share a common ancestor with both. We have a much more recent common ancestor with chimps. The dates derived from DNA and from...
-
Dear Jim,
A draft version of the pig (Sus scrofa) genome has recently been completed. See NCBI Pig Genome Resources
I haven’t seen any overall % identity number, but one can say “The pig genome is...
-
I thought I would expand on Jeremiah333 answer
“Modern man” is called Homo sapiens and has been around for about 250,000. However the Homo genus is perhaps two million years old.
Which of our...
-
An epitope is a region of a protein which an antibody binds to. A protein is a linear chain that folds up in a complex manner. If the antibody binds to a continuous amino acid sequence of the...
-
Here is a couple more things to think about.
Sometimes tumors spread by the lymphatic system & sometimes by the blood. You can frequently detect tumor cells circulating in the blood from patients...
-
Hi Katie,
You have a good model in mind & it could work in certain cancer & non-cancerous conditions. For example, cutting off the blood supply is the method used to castrate baby goats & calves....
-
-
No, the specific binding will show up with the ConA & the addition of AMM will block this.
The AMM will block all of the ConA binding that's lectin specific & leave you with the NSB. So ConA-AMM...
-
ConA is a lectin. It binds to specific kinds of sugars that are found on proteins.
You can detect protein which contain these sugars (glycoproteins) by ConA binding to them (ex in a Western Blot) ...
-
Chloroplasts are most similar to the cyanobacteria (=blue-green algae) because they share a common evolutionary ancestor. This explanation for their similarities is called the endosymbiotic theory.
-
First look at liposome in Wikipedia Liposome - Wikipedia, the free encyclopedia
Then Google "lipofectin". This is a research product widely used to introduce DNA into cells
-
I suspect this is a homework question. So I'll just give you some hints.
You need to know three things:
"An average heart pumps 2.4 ounces (70 milliliters) per heartbeat"
"An average heartbeat is...
-
I have looked at these plots before, but I’m not an expert at this.
This is a plot of predicted membrane spanning regions in a protein. The x-axis in the amino position (N term = 1) in the protein...
-
If you’re studying evolutionary relationships, by looking at bones, you need to think about disease process that could change / shape bones. There are a number of genetic diseases (= diseases that...
-
Undiscovered? What are you talking about?
10% of our genes certainly aren’t remaining to be discovered.
Of course you could invoke the Rumsfeld “unknown unknowns” (As I remember it “there are...
-
It is the full set of genes found in humans. In other words it is all of the DNA that codes for this set of genes (~22,000). People receive 1 copy of each gene from each parent. So the genome...
-
Since this appears to be a homework question I’ll just give you a couple of hints.
First, Region 1 is longer
Second, Region 2 has a much higher G+C content
Which has the higher Tm? Try...
-
An animal cell would certainly shrivel-up and die, but halohiles would not only survive but thrive. Halophiles are organisms (bacteria & archaea) that “like” high salt conditions. Some groups of...
-
Did you want a method?
You can look in Food Analysis Laboratory Manual by S. Suzanne Nielsen (available for free @ books.google.com) for the “official method” for measuring vit C in fruit juices...
-
I'm confident that "polymerese" is a typo & that they meant polymerase.
-
First what is a liposome?. from Wikipedia "A liposome is a tiny bubble (vesicle), made out of the same material as a cell membrane. Liposomes can be filled with drugs, and used to deliver drugs for...
-
First, what is the mole fraction that is O2? =X
0.55 + 0.25 + Z = 1
Second, at STP, the volume of 1 Mole is 22.4 L
5 /22.4 = Y
Third, 1 mole is 6.02E23 molecules
so 6.02E23 * Y = # of...
-
Yes, the chloroplast has a circular DNA like a bacteria & unlike the linear chromosome of eukaryotes. However the size of the chloroplast genome (100 – 300Kb) is about 1/10 the size of a bacterial...
-
I hope this isn't a homework question!
3 g/ml is 51.3 M. I don't believe this is possible.
did you mean 3 g /L?
that is = 0.051 M (FW of NaCl = 58.44)
-
Thanks for responding,
I hope to avoid hospitals, but when I'm in one I hope to run into a RN like you
-
I have a PhD and had taught genetics to undergraduates (including nursing students) at an American University for more than 10 years. You shouldn’t have to look this up. This is a simple "Mendelian...
-
A reference for a dihybrid cross or my reference?
-
J_9 is mistaken.
There are two separate traits here The AB blood group & the Rh blood group.
At the AB locus, Mom has an A and a B allele while Dad has 2 O alleles. So 1/2 of the children will...
-
Right, 100 ml is 1/10 of a liter
So, if you have 343 gm in 1 liter how much do you have in 1/10 of a liter
OK?
-
Also, it will depend on how much air (oxygen) is in the container. A gallon of gas in a gallon container will last longer than a quart of gas in the same container
-
You need to know the formula (= molecular) weight of sucrose =342 grams per mole
& you need to understand the concept of a mole.
1 L of a 1 M solution will contain 343 gm of sucrose
... a 2 M...
-
-
I'm sure you have looked up micromillimeter and found that it's a metric unit of length equal to one billionth of a meter. But this isn't the preferred SI unit (International System of Units). The...
-
Simply put, they are in a sense opposites.
A pleiotropic gene is a gene that affects more than one trait, while a polygenic trait is the result of the interaction on several genes.
-
If your want to "use" this RNA you need to keep track of the ends
DNA & RNA sequences are written 5' -> 3' so the complement of
5' AUGUCGAUCACCAUUGAAGGUAGACUG 3' would be written as
5'...
-
Is the idea that you want to create a fine particle suspension that will settle onto the bottom of a container creating a film of particles which you see the movement of snails?
Do you have a...
-
Close..
the equation is:
6 min. per apple * 6.02 * 10^(23) apples /1 mole of apples
-
So what you need to know first is that MSG is the sodium salt of glutamate (= glutamic acid). Next it would be helpful to know that glutamate is an amino acid (a building block of proteins).
The...
-
All of the details involved in the inheritance of hair color haven’t been worked out yet, but you can get a brown hair in a child using just two hair color genes. See Human hair color - Wikipedia,...
-
What if Dad was heterozygous for A?
Then the baby could be either A or B
Right?
In a similar manner Dad could be either heterozygous or homozygous for the Rh trait
So the baby could be either...
-
Yes, it is possible.
There is a rare blood type called hh (Bombay blood group) which prevent the expression of the A & B antigens. So a person who has the A and/or B alleles (genotype) will have...
-
The conventional model of differentiation is when a cell (stem cell) can develop into anther another cell typically be means of series of intermediate cell types. Each intermediate cell type has...
-
It depends... media... cell density
But 20 hours would be a reasonable time
-
This isn’t a simple question ;)
First, there are several kinds of introns. I’m will focus on the group II introns found in eukaryotic genes (See the Wikipedia intron entry Intron - Wikipedia, the...
-
First, it is an inaccurate over simplification to simply look at the possible products of meiosis and say that the sex ratios at birth must be 1:1
A lot can happen, both before conception (primary...
|