Ask Experts Questions for FREE Help !
Ask
    amber amerson's Avatar
    amber amerson Posts: 1, Reputation: 1
    New Member
    		  
    #1

    Apr 21, 2008, 04:44 PM
    What is the complementary base for.
    What is the complementary base for AUGUCGAUCACCAUUGAAGGUAGACUG?
    massplumber2008's Avatar
    massplumber2008 Posts: 12,832, Reputation: 1212
    Senior Plumbing Expert
    		  
    #2

    Apr 21, 2008, 04:55 PM
    This is an RNA strand...

    The complimentary base is as follows:

    A gets U
    C gets G
    G gets C
    U gets A

    So... AUGUCGAUCACCAUUGAAGGUAGACUG complimentary base should be:

    UACAGCUAGUGGUAACUUCCAUCUGAC.

    Good luck!
    jem02081's Avatar
    jem02081 Posts: 65, Reputation: 19
    Junior Member
    		  
    #3

    Apr 21, 2008, 06:37 PM
    If your want to "use" this RNA you need to keep track of the ends
    DNA & RNA sequences are written 5' -> 3' so the complement of
    5' AUGUCGAUCACCAUUGAAGGUAGACUG 3' would be written as
    5' CAGUCUACCUUCAAUGGUGAUCGACAU 3'
Not your question? Ask your question View similar questions
 

Question Tools Search this Question
Search this Question:

Advanced Search

Add your answer here.


Check out some similar questions!

Gold base and blue base hair color [ 2 Answers ]

I have many times colored my hair in years past. I always used miss clairols blondest beige and it always turned out fine. About 4 years ago I grew it all out my natural color. Light light brown (dishwater blonde) Anyway.. last night.. I decided to color my hair I bought lightest golden blonde...

Is Life Contradictory Or Complementary? [ 1 Answers ]

Is it important to acknowledge the reality and importance of non-rational modes of knowing, such as intuition, integrative awareness and contemplation? HANK ;)

Shiatsu as a complementary therapy. [ 1 Answers ]

Hello, Can anyone enlighten me on the general consensus with regard to shiatsu as a bodywork that promotes good health / general wellbeing? Someone recommended it to me when I told them I was pregnant. Thanks in advance.

Shower base [ 1 Answers ]

I am installing a shower base on a concrete slab. Do I need to set the base in thin set or can I just set it on top of the slab and nail it to the wall studs? The shower base has foam underneith it for support.

Base molding [ 2 Answers ]

How do you install base molding to metal studs

View more questions Search