Ask Experts Questions for FREE Help !
Ask
    N0help4u's Avatar
    N0help4u Posts: 19,823, Reputation: 2035
    Uber Member
    		  
    #1

    Jul 26, 2009, 06:41 PM
    Cheese not melting
    I have had a problem every time I go to make baked homemade macaroni and cheese.
    The cheese doesn't melt any more. It globs up and doesn't mix with the sauce.
    I think it is because they probably make it low fat without the fat content that it use to contain. I think they are making cheese like this as the norm now so they don't bother listing it as low fat.
    I know cheese will be stringy if it is older but this was new cheese that I bought at GFS.
    Plus it isn't so much stringy as it is globby.

    Has anybody had this problem and what do you think it might be?
    nikosmom's Avatar
    nikosmom Posts: 1,611, Reputation: 488
    Ultra Member
    		  
    #2

    Jul 26, 2009, 06:50 PM

    I know Fat-free cheese doesn't melt as well but I've never had a problem when I use low-fat cheese. I usually mix a little milk in as well before I bake because it helps the cheese turn into a 'sauce'.
    N0help4u's Avatar
    N0help4u Posts: 19,823, Reputation: 2035
    Uber Member
    		  
    #3

    Jul 26, 2009, 06:54 PM

    That's what I usually do but it didn't turn out again. I gave up and put it in the fridge. I'll probably try again tomorrow but hope I get some tips before then
    I even added a couple tablespoons of butter which I seldom do and still didn't help

    Thanks
    Torrid13's Avatar
    Torrid13 Posts: 637, Reputation: 149
    Senior Member
    		  
    #4

    Jul 26, 2009, 06:57 PM

    I was going to suggest milk or butter as well, but apparently that's not working.

    Maybe the temperature needs to be adjusted?
    danielnoahsmommy's Avatar
    danielnoahsmommy Posts: 2,506, Reputation: 297
    Ultra Member
    		  
    #5

    Jul 26, 2009, 07:46 PM

    When I make macaroni and cheese I start of with a rue. I add butter and flour. (melt butter in pan... wait till melted whisk in flour until dissolved cook over medium heat for about 3-5 min until browned. Must cook flour. Then add cheese. I don't bother with the fat free, it just does nothing for the meal

    After cheese is melted into the rue I add the cooked macaroni and mix well. Pour into casserole and top with additional cheese and bake at 325 for about 40 min or until cheese on top is brown and bubbely.
    Just Dahlia's Avatar
    Just Dahlia Posts: 2,155, Reputation: 445
    Ultra Member
    		  
    #6

    Jul 27, 2009, 11:37 AM
    I've never had any problem with cheese melting unless I am making fondue, than I have to be quick. I never use low fat of any kind though, always whole milk cheeses.:)

    If your trying it again today, heat up the globs with just a very little milk and butter until smooth and then add milk tiny bits at a time, stirring after each addition. The rue idea is also good.
    N0help4u's Avatar
    N0help4u Posts: 19,823, Reputation: 2035
    Uber Member
    		  
    #7

    Jul 27, 2009, 11:39 AM

    Yeah I want whole milk cheese but it seems they are starting to make things low fat and
    Don't feel the need to label it that way.
Not your question? Ask your question View similar questions
 

Question Tools Search this Question
Search this Question:

Advanced Search

Add your answer here.


Check out some similar questions!

DNA Melting [ 2 Answers ]

Here are the DNA sequences from 2 different regions of the genome of an organism. Region 1: 3’ – ATTAGAATGGTTAGCCAATATATA – 5’ Region 2: 3’ – GGCTGCCAGCGCAGGGCTTAGG – 5’ Which of these would require a higher temperature to melt & why?

Melting Granite. [ 3 Answers ]

Hi! My name is DJ, and my question is: What is the "hardest granite" it's name, the easiest to obtain, and how do I melt it?

The melting princess [ 10 Answers ]

Once upon a time there lived a king. The king had a beautiful daughter, the PRINCESS, but there was a problem. Everything the princess touched would Melt, no matter what; Metal, Wood, Stone,

Melting point [ 3 Answers ]

Given that the melting point of water at 218 atm is 1.61 Celsius degree,what is the melting point of water at 0.5 atm? :) Can anyone show me step by step for the calculation? :D Thanks a lot to anyone who help me to solve the problem.your help is most appreciated. :) :)

View more questions Search