Ask Experts Questions for FREE Help !
Ask

What is the complementary base for.

Asked Apr 21, 2008, 04:44 PM — 2 Answers
What is the complementary base for AUGUCGAUCACCAUUGAAGGUAGACUG?

Search this Thread
Share |
2 Answers
massplumber2008's Avatar
massplumber2008 Posts: 10,557, Reputation: 5092
Plumbing Expert
  
#2

Apr 21, 2008, 04:55 PM
This is an RNA strand...

The complimentary base is as follows:

A gets U
C gets G
G gets C
U gets A

So...AUGUCGAUCACCAUUGAAGGUAGACUG complimentary base should be:

UACAGCUAGUGGUAACUUCCAUCUGAC.

Good luck!
Helpful  (1)
jem02081's Avatar
jem02081 Posts: 64, Reputation: 90
Junior Member
  
#3

Apr 21, 2008, 06:37 PM
If your want to "use" this RNA you need to keep track of the ends
DNA & RNA sequences are written 5' -> 3' so the complement of
5' AUGUCGAUCACCAUUGAAGGUAGACUG 3' would be written as
5' CAGUCUACCUUCAAUGGUGAUCGACAU 3'
Helpful
Not your question? Ask your question View similar questions
 
Thread Tools Search this Thread
Search this Thread:

Advanced Search

Add your answer here.

Remove Text Formatting
 

Undo
Redo
  
Decrease Size
Increase Size
Bold
Italic
Underline
Align Left
Align Center
Align Right
Ordered List
Unordered List
Decrease Indent
Increase Indent
Insert Email Link
Wrap [QUOTE] tags around selected text
Wrap [CODE] tags around selected text
Wrap [HTML] tags around selected text
Wrap [PHP] tags around selected text
Wrap [YOUTUBE] tags around selected text
Notification Type:



Check out some similar questions!

Gold base and blue base hair color [ 2 Answers ]

I have many times colored my hair in years past. I always used miss clairols blondest beige and it always turned out fine. About 4 years ago I grew it all out my natural color. Light light brown (dishwater blonde) Anyway..last night.. I decided to color my hair I bought lightest golden blonde...

Is Life Contradictory Or Complementary? [ 1 Answers ]

Is it important to acknowledge the reality and importance of non-rational modes of knowing, such as intuition, integrative awareness and contemplation? HANK ;)

Shiatsu as a complementary therapy. [ 1 Answers ]

Hello, Can anyone enlighten me on the general consensus with regard to shiatsu as a bodywork that promotes good health / general wellbeing? Someone recommended it to me when I told them I was pregnant. Thanks in advance.

Shower base [ 1 Answers ]

I am installing a shower base on a concrete slab. Do I need to set the base in thin set or can I just set it on top of the slab and nail it to the wall studs? The shower base has foam underneith it for support.

Base molding [ 2 Answers ]

How do you install base molding to metal studs

View more Biology questions Search