Ask Experts Questions for FREE Help!
  Advanced
Register  |  Log in  
   Ask    
 Answer  
  Help  

Ask QuestionsprogressAnswer QuestionsprogressBuild ReputationprogressBecome an Expert
 
Free Answers in 3 Easy Steps

Register Now
3 Steps

At Ask Me Help Desk you can ask questions in any topic and have them answered for free by our experts. To ask questions or participate in answering them you must register for a free account. By registering you will be able to:
  • Get free answers from experts in any of our 300+ topics.
  • Accept money for answers that you provide.
  • Communicate privately with other members (PM).
  • See fewer ads.

Home > Science > Biology   »   What is the complementary base for.

 
Question Tools Search this Question Display Modes
Question
 
 
#1  
Old Apr 21, 2008, 03:44 PM
amber amerson
New Member
amber amerson is offline
 
Join Date: Apr 2008
Posts: 1
amber amerson See this member's comment history on his/her Profile page.
What is the complementary base for.

What is the complementary base for AUGUCGAUCACCAUUGAAGGUAGACUG?

Reply With Quote
 
     

Answers
 
 
Old Apr 21, 2008, 03:55 PM   #2  
massplumber2008
Plumbing Expert
massplumber2008 is online now
 
massplumber2008's Avatar
 
Join Date: Jan 2008
Location: Boston, Massachusetts
Posts: 2,604
massplumber2008 See this member's comment history on his/her Profile page.massplumber2008 See this member's comment history on his/her Profile page.massplumber2008 See this member's comment history on his/her Profile page.
This is an RNA strand...

The complimentary base is as follows:

A gets U
c gets G
g gets C
U gets A

So...AUGUCGAUCACCAUUGAAGGUAGACUG complimentary base should be:

UACAGCUAGUGGUAACUUCCAUCUGAC.

Good luck!!

Comments on this post
Fr_Chuck agrees: ok a plumber that knows DNA strands, is anyone else worried
  Reply With Quote
 
     
 
 
Old Apr 21, 2008, 05:37 PM   #3  
jem02081
New Member
jem02081 is offline
 
Join Date: Nov 2007
Location: Massachusetts
Posts: 29
jem02081 See this member's comment history on his/her Profile page.
If your want to "use" this RNA you need to keep track of the ends
DNA & RNA sequences are written 5' -> 3' so the complement of
5' AUGUCGAUCACCAUUGAAGGUAGACUG 3' would be written as
5' CAGUCUACCUUCAAUGGUGAUCGACAU 3'
  Reply With Quote
 
     


Question Tools Search this Question
Search this Question:

Advanced Search
Display Modes

 
Similar Sponsors

Similar Questions
Question Asker Topic Answers Last Post
Shiatsu as a complementary therapy. poppy_seed Alternative Medicine 1 Aug 28, 2007 11:34 AM
shower base johnny cos Plumbing 1 Jan 7, 2007 05:40 AM
base molding thomas falcone Interior Home Improvement 2 Dec 4, 2006 11:38 AM
gold base and blue base hair color tracyfast Hair Care 1 Oct 16, 2006 06:15 PM
Is Life Contradictory Or Complementary? HANK Philosophy 0 Mar 26, 2005 09:39 AM




Copyright ©2003 - 2007, Ask Me Help Desk.
All times are GMT -8. The time now is 11:44 AM.

Content Relevant URLs by vBSEO 3.0.0 RC6 © 2006, Crawlability, Inc.